Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd

Wprowadziliśmy [33P] deoksy-ATP do fragmentów DNA wytworzonych w procedurze PCR przez dodanie 2 mikrolitrów (10 mikro Ci) [33P] deoksy-ATP na 500 mikrolitrów mieszanin reakcyjnych i przez zmniejszenie stężeń nieznakowanego deoksy-ATP do 50 mM. W niektórych eksperymentach końcowy znakowano primer oligonukleotydowy 5 za pomocą [32P] .-ATP przed przeprowadzeniem PCR zamiast włączania [33P] deoksy-ATP podczas procesu amplifikacji. Wyznakowane produkty PCR rozdzielono na żelu sekwencjonującym (pomiar 0,4 mm na 20 mm na 60 mm) w temperaturze 60 do 80 W mocy stałej przez dwie do czterech godzin. Żele umieszczono w plastikowym opakowaniu i wystawiono na działanie filmu rentgenowskiego przez jeden do pięciu dni w temperaturze pokojowej. Polimorfizm EVI-20 wykryto przednim starterem 5 CCCATACCTAGTTCTTAAAGTCTGT3 i odwrotnym primerem 5 TAACAATTGTGGAACTGCAGCAATTATT3 . Amplifikacja składała się z 26 cykli denaturacji w 94 ° C przez jedną minutę, hybrydyzacji w 67 ° C przez jedną minutę i wydłużania w 72 ° C przez jedną minutę; stężenie chlorku magnezu wynosiło 2 mM, a allele wykryto na żelu zawierającym 5 procent akryloamidu, 6 M mocznik i 32 procent dejonizowanego formamidu. Testowaliśmy produkty amplifikacji na 5-procentowym minigelu akryloamidowym (pomiar 1,0 mm na 10 cm na 10 cm) przed załadowaniem dużych żeli i przeprowadzono cztery do ośmiu dodatkowych cykli PCR, jeśli produkty nie były wizualizowane. Ta procedura zminimalizowała wzmocnienie produktów tła. EVI-20 wykrywa cztery powszechne allele od 200 do 210 par zasad (bp). Polimorfizm UT172 wykryto przednim primerem 5 GGTGAAAGAGCAAGACTCTGTCAC3 i odwrotnym primerem 5 CCCCTTGATTGTAAGCNACAGAAAC3 . Amplifikacja składała się z 32 cykli denaturacji w 94 ° C przez 45 sekund, hybrydyzacji w 52 ° C przez 45 sekund i wydłużania w 72 ° C przez 45 sekund; stężenie chlorku magnezu wynosiło 2,5 mM, a allele wykryto na żelu zawierającym 6 procent akryloamidu, 6 M mocznika i 10 procent dejonizowanego formamidu. UT172 wykrywa cztery wspólne allele od 100 do 120 pz. W celu wykrycia innych loci wykorzystaliśmy techniki amplifikacji opisane przez Xu i wsp., 26 Andersen i wsp., 27 i Futreal i wsp., 29 zgodnie z zaleceniami autorów.
Wyniki
Rysunek 1. Ryc. 1. Utrata heterozygotyczności w obrębie i blisko NF1 w próbkach szpiku kostnego od pacjentów. W panelu A DNA wyekstrahowany z próbki szpiku kostnego od pacjenta i próbki krwi od rodziców strawiono EcoRI, hybrydyzowano z sondą EVI-2B (top blot) i zamplifikowano za pomocą starterów wykrywających polimorficzny powtórzenie NF1 Alu 26 ( dolny blot). DNA pacjenta pokazuje tylko zmutowany matczyny gen NF1. W Panelu B DNA od Pacjenta 2 i jego rodziców zostało zamplifikowane ze starterami, które wykrywają powtórzenie EVI-20 (top blot) i polimorfizm sekwencji opisany przez Andersena i wsp. 27 (dolny blot). W DNA pacjenta utracono normalny matczyny gen NF1 i zachowano zmutowany allel ojcowski. W Panelu C DNA od Pacjenta 6 i jego rodziców zostało zamplifikowane za pomocą starterów wykrywających polimorfizmy EVI-20 (top blot) i UT172 (dolny blot). Zmutowany macierzyński allel NF1 jest zachowany u tego pacjenta z monosomią 7 (Mo 7) szpiku kostnego. W panelu D DNA od Pacjenta 8 i jego rodziców było amplifikowane za pomocą starterów wykrywających polimorfizm UT172
[hasła pokrewne: cienki stolec przyczyny, endometrioza co to za choroba, kamagra bez recepty ]

Dodaj komentarz

Twój adres email nie zostanie opublikowany. Pola, których wypełnienie jest wymagane, są oznaczone symbolem *

Powiązane tematy z artykułem: cienki stolec przyczyny endometrioza co to za choroba kamagra bez recepty