Po Babesioza Ciepła autoimmunologiczna niedokrwistość hemolityczna ad 5

Jedyny pacjent, u którego zespół rozwinął się 3 lata po allogenicznym przeszczepieniu komórek macierzystych, miał samowystarczalny przebieg bez potrzeby immunosupresji, co sprawia, że zjawisko podobne do choroby typu przeszczep przeciwko gospodarzowi jest mało prawdopodobne. Tylko jeden pacjent z zespołem otrzymał transfuzję w ciągu 3 miesięcy przed prezentacją i nie wykryto żadnych alloprzeciwciał. Wywołana przez lek autoimmunizacyjna niedokrwistość hemolityczna jest mało prawdopodobna, ponieważ tylko jeden pacjent otrzymał chininę16, a niedokrwistość hemolityczna autoimmunizacyjna nie była powiązana z atowakwonem, azytromycyną ani klindamycyną.17 Chociaż testy PCR dla B. microti pozostały pozytywne w pięciu z sześciu przypadków w czas diagnozy WAHA, nie było dowodów na parazytemię na rozmaz krwi obwodowej. Badanie mikroskopowe wybarwionych Giemzą grubych i cienkich plamek krwi ma granicę wykrywalności od 10 do 100 pasożytów na mikrolitr (0,0002 do 0,002% parazytemii), podczas gdy testy PCR dla B. Read more „Po Babesioza Ciepła autoimmunologiczna niedokrwistość hemolityczna ad 5”

Stosowanie litu w ciąży i ryzyko wad rozwojowych serca

Obawiano się, że ekspozycja na lit we wczesnej ciąży może wiązać się z wyraźnym wzrostem ryzyka anomalii Ebsteina (defekt niedrożności dróg odpływowych prawej komory) u niemowląt i ogólnie wrodzonych wad serca, ale dane są sprzeczne i ograniczone. Metody
Przeprowadziliśmy kohortowe badanie obejmujące 1355 563 ciąże u kobiet, które zostały zarejestrowane w Medicaid i które urodziły żywego niemowlęcia w latach 2000-2010. Przeanalizowaliśmy ryzyko malformacji serca u niemowląt wystawionych na działanie litu w pierwszym trymestrze ciąży w porównaniu z nienaświetlonymi niemowlętami i w analizach wtórnych u niemowląt narażonych na działanie innego powszechnie stosowanego stabilizatora nastroju, lamotryginy. Wskaźniki ryzyka i 95-procentowe przedziały ufności zostały oszacowane z uwzględnieniem warunków psychiatrycznych i medycznych, leków i innych potencjalnych czynników zakłócających.
Wyniki
Wady serca były obecne u 16 z 663 niemowląt poddanych ekspozycji na lit (2,41%), 15 251 z 322 955 niesortowanych niemowląt (1,15%) i 27 z 1945 niemowląt poddanych działaniu lamotryginy (1,39%). Read more „Stosowanie litu w ciąży i ryzyko wad rozwojowych serca”

Fenotyp i przebieg zespołu progresywnego Hutchinsona-Gilforda ad 5

Pięć najstarszych dzieci miało podwyższony puls dla wieku. Wysycenie tlenem wyniosło ponad 95% dla wszystkich 13 badanych dzieci. Pięcioro dzieci, w tym troje najstarszych, miało długie odstępy QT (tabela 2) na testach elektrokardiograficznych. Dwóch z nich miało dowody na przerost dwudzielny i powiększenie biatomu. Pacjent 14 miał głęboką falę Q w odprowadzeniu V1, a Pacjent 15 miał nieprawidłowe fale ST-T i krótki odstęp PR. Read more „Fenotyp i przebieg zespołu progresywnego Hutchinsona-Gilforda ad 5”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 czesc 4

Normalny matczyny allel jest obecny w szpiku kostnym Pacjenta 8. W Tablicy E DNA z Pacjenta 11 i jej rodziców zostało zamplifikowane ze starterami, które wykrywają polimorfizm EVI-20 (top blot) i polimorfizm opisany przez Andersena i wsp.27. (dolna plama). Macierzysty allel NF1 został usunięty u pacjenta. JCML oznacza młodzieńczą przewlekłą białaczkę szpikową i przewlekłą białaczkę mielomonocytową CMML. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 czesc 4”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd

Wprowadziliśmy [33P] deoksy-ATP do fragmentów DNA wytworzonych w procedurze PCR przez dodanie 2 mikrolitrów (10 mikro Ci) [33P] deoksy-ATP na 500 mikrolitrów mieszanin reakcyjnych i przez zmniejszenie stężeń nieznakowanego deoksy-ATP do 50 mM. W niektórych eksperymentach końcowy znakowano primer oligonukleotydowy 5 za pomocą [32P] .-ATP przed przeprowadzeniem PCR zamiast włączania [33P] deoksy-ATP podczas procesu amplifikacji. Wyznakowane produkty PCR rozdzielono na żelu sekwencjonującym (pomiar 0,4 mm na 20 mm na 60 mm) w temperaturze 60 do 80 W mocy stałej przez dwie do czterech godzin. Żele umieszczono w plastikowym opakowaniu i wystawiono na działanie filmu rentgenowskiego przez jeden do pięciu dni w temperaturze pokojowej. Polimorfizm EVI-20 wykryto przednim starterem 5 CCCATACCTAGTTCTTAAAGTCTGT3 i odwrotnym primerem 5 TAACAATTGTGGAACTGCAGCAATTATT3 . Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 5

Wyniki analizy mającej na celu zidentyfikowanie czynników predykcyjnych wyników dotyczących wskaźnika leczenia bólu przedstawiono w Tabeli 2. Poza typem populacji obsługiwanej przez instytucję (mniejszość vs nieminoralność) przewidywano szereg innych zmiennych demograficznych i związanych z chorobą wyniki. Im większa rozbieżność między lekarzem a pacjentem w ocenie stopnia zakłócenia wywołanego bólem z aktywnością, tym bardziej prawdopodobny jest wynik ujemny. Negatywny wynik był również bardziej prawdopodobny u pacjentów, których ból nie był związany z rakiem, pacjentów, którzy byli w najstarszym kwartylu próbki (70 lat lub starszych), pacjentów, którzy zostali uznani za mniej chorych (lepszy stan sprawności ECOG), oraz kobiety (ryc. 1). Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 5”