Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego

Szereg badań z udziałem pacjentów z ostrym udarem niedokrwiennym wykazało lepsze wyniki funkcjonalne po leczeniu wewnątrznaczyniowym niż w przypadku leczenia konwencjonalnego po 90 dniach od rozpoczęcia leczenia. Jednak brakuje wyników długoterminowych wyników klinicznych. Metody
Ocenialiśmy wyniki kliniczne 2 lata po losowym przydzieleniu pacjentów do grupy leczonej endowaskularnie (grupa interwencyjna) lub konwencjonalnej (grupa kontrolna) w ostrym udarze niedokrwiennym. Pierwszorzędnym wynikiem był wynik zmodyfikowanej skali Rankina po 2 latach; ta skala mierzy wynik czynnościowy, z ocenami od 0 (bez objawów) do 6 (śmierć). Drugorzędne wyniki obejmowały umieralność ogólną i jakość życia po 2 latach, mierzone za pomocą wskaźnika użyteczności zdrowotnej, który opiera się na kwestionariuszu European Quality of Life-5 Dimensions (zakres ocen od -0,339 do 1, z wyższymi wynikami wskazujące na lepsze zdrowie). Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego”

Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5

Spośród 332 pacjentów już zapisanych w pierwotnym badaniu, 14 (4,2%) przeszło 2-letni okres obserwacji, a 87 (40 w grupie interwencyjnej i 47 w grupie kontrolnej) zmarło przed przedłużonym okresem obserwacji rozpoczął się okres. Spośród pozostałych 231 pacjentów włączonych do pierwotnego badania, ci, którzy nie wyrazili świadomej zgody na udział w rozszerzonym badaniu kontrolnym początkowo zostali ponownie zaproszeni do udziału: 61 pacjentów odmówiło, a 8 pacjentów wycofało zgodę w okresie obserwacji ( z tych 69 pacjentów, 18 było w grupie interwencyjnej, a 51 w grupie kontrolnej). W sumie 26 pacjentów straciło czas na obserwację. Ogółem 391 z 500 pacjentów (78,2%) miało 2-letnie dane kontrolne i włączono je do pierwotnej analizy wyników czynnościowych (194 w grupie interwencyjnej i 197 w grupie kontrolnej) (ryc. S1 w Dodatek). Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5”

Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5

Spośród 332 pacjentów już zapisanych w pierwotnym badaniu, 14 (4,2%) przeszło 2-letni okres obserwacji, a 87 (40 w grupie interwencyjnej i 47 w grupie kontrolnej) zmarło przed przedłużonym okresem obserwacji rozpoczął się okres. Spośród pozostałych 231 pacjentów włączonych do pierwotnego badania, ci, którzy nie wyrazili świadomej zgody na udział w rozszerzonym badaniu kontrolnym początkowo zostali ponownie zaproszeni do udziału: 61 pacjentów odmówiło, a 8 pacjentów wycofało zgodę w okresie obserwacji ( z tych 69 pacjentów, 18 było w grupie interwencyjnej, a 51 w grupie kontrolnej). W sumie 26 pacjentów straciło czas na obserwację. Ogółem 391 z 500 pacjentów (78,2%) miało 2-letnie dane kontrolne i włączono je do pierwotnej analizy wyników czynnościowych (194 w grupie interwencyjnej i 197 w grupie kontrolnej) (ryc. S1 w Dodatek). Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5”

Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego czesc 4

Śmiertelność z wszystkich przyczyn oceniano za pomocą metody Kaplana-Meiera i modelu proporcjonalnych hazardów Coxa, przy czym współczynnik ryzyka jako zmienną efektu. Dane wszystkich 500 pacjentów poddanych randomizacji w pierwotnym badaniu włączono do analizy śmierci z dowolnej przyczyny. Dodatkowe informacje z holenderskiej miejskiej bazy danych osobowych na temat zasadniczego stanu po 2 latach zostały wykorzystane do analizy wyników, a dane dotyczące pacjentów, których brakowało istotnego statusu, zostały ocenzurowane w momencie wycofania się z badania. W celu analizy jakości życia, wartość użyteczności dla każdego obserwowanego profilu stanu zdrowia EQ-5D-3L obliczono z wykorzystaniem istniejącego algorytmu na podstawie wyceny wywołanej przez techniki time-off stosowane w ogólnej populacji holenderskiej. Niestandaryzowany parametr regresji beta oszacowano przy użyciu wielozmiennego modelu regresji liniowej i przedstawiono różnicę między dwiema grupami leczenia w wyniku oceny użyteczności zdrowotnej. Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego czesc 4”

Choroba Pageta żuchwy

55-letni mężczyzna przedstawił 2-letnią historię bolesnego powiększania szczęki i stopniowo źle dopasowanych protez. Nie miał żadnych bólów głowy ani wad pola widzenia i nie miał nadmiernej potliwości, tłustej skóry, nietolerancji glukozy, niewydolności serca ani wzrostu rozmiaru rękawicy lub buta. Całą żuchwę powiększono obustronnie do kąta żuchwy (panele A i B), z zaznaczoną niewspółosiowością zębów górnych i dolnych. Poziom insulino-podobnego czynnika wzrostu I był prawidłowy przy 15,2 nmol na litr (normalny zakres, 9 do 40), ale poziom fosfatazy alkalicznej w surowicy i fosfatazy alkalicznej specyficznej dla kości były podwyższone (154 IU na litr [normalny poziom, < 120] i 92 IU na litr [normalny zakres, 15 do 41], odpowiednio). Badanie kości wykazało zwiększony wychwyt radionuklidu w szczęce (panel C); nie były zaangażowane żadne inne kości. Read more „Choroba Pageta żuchwy”

Leczenie komplikacji czerniaka za pomocą Natalizumabu na stwardnienie rozsiane

Obrazy siatkówki pacjenta 2. Panel A pokazuje prawy znamion naczyniówki, który był stabilny od co najmniej 1999 r. I który był uważnie obserwowany jako część częstych badań okulistycznych w zapaleniu nerwu wzrokowego i samym nevusie. Podczas rutynowego badania w listopadzie 2006 r., Po podaniu kilku dawek natalizumabu, zaobserwowano dramatyczny wzrost wielkości, głębokości i pigmentacji nerek i zdiagnozowano czerniaka ocznego (panel B).
Opisujemy dwa przypadki czerniaka u kobiet ze stwardnieniem rozsianym leczonych natalizumabem (Tysabri, Biogen Idec i Elan Pharmaceuticals), humanizowanym przeciwciałem monoklonalnym przeciwko integrynie .4. Read more „Leczenie komplikacji czerniaka za pomocą Natalizumabu na stwardnienie rozsiane”

Wydarzenia sercowo-naczyniowe podczas Pucharu Świata w Piłce Nożnej czesc 4

Współczynniki zachorowalności na zdarzenia sercowo-naczyniowe w dniach podczas mistrzostw świata, w porównaniu z dniami w okresie kontrolnym, w całej grupie iw podgrupach. Tabela 2. Tabela 2. Charakterystyka pacjentów, u których wystąpił ostry incydent sercowo-naczyniowy w dniach podczas Pucharu Świata w porównaniu z Dniami w Okresie Kontrolnym. Ciśnienie barometryczne było dodatnio związane ze wzrostem liczby zdarzeń sercowo-naczyniowych (wskaźnik zapadalności, 1,12 na 10 hPa), podobnie jak rok 2006 (1,15), wtorek (1,13) i niedziela (1,07); Sobota pokazała negatywne skojarzenie (0,78). Read more „Wydarzenia sercowo-naczyniowe podczas Pucharu Świata w Piłce Nożnej czesc 4”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd

Wprowadziliśmy [33P] deoksy-ATP do fragmentów DNA wytworzonych w procedurze PCR przez dodanie 2 mikrolitrów (10 mikro Ci) [33P] deoksy-ATP na 500 mikrolitrów mieszanin reakcyjnych i przez zmniejszenie stężeń nieznakowanego deoksy-ATP do 50 mM. W niektórych eksperymentach końcowy znakowano primer oligonukleotydowy 5 za pomocą [32P] .-ATP przed przeprowadzeniem PCR zamiast włączania [33P] deoksy-ATP podczas procesu amplifikacji. Wyznakowane produkty PCR rozdzielono na żelu sekwencjonującym (pomiar 0,4 mm na 20 mm na 60 mm) w temperaturze 60 do 80 W mocy stałej przez dwie do czterech godzin. Żele umieszczono w plastikowym opakowaniu i wystawiono na działanie filmu rentgenowskiego przez jeden do pięciu dni w temperaturze pokojowej. Polimorfizm EVI-20 wykryto przednim starterem 5 CCCATACCTAGTTCTTAAAGTCTGT3 i odwrotnym primerem 5 TAACAATTGTGGAACTGCAGCAATTATT3 . Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad

Zbadaliśmy próbki DNA z 11 rodzin, w których złośliwe zaburzenie szpiku rozwinęło się u dziecka z NF-1 i przedstawiliśmy dane sugerujące NF1 jako supresor guza w komórkach hematopoetycznych linii mieloidalnej. Metody
Tabela 1. Tabela 1. Cechy dzieci z NF-1 i złośliwymi zaburzeniami szpikowymi. Przebadaliśmy 10 chłopców i dziewczynę z NF-1 i MPS (9 pacjentów) lub AML (2 pacjentów), którzy byli leczeni w pediatrycznych ośrodkach referencyjnych. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad”