Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego

Szereg badań z udziałem pacjentów z ostrym udarem niedokrwiennym wykazało lepsze wyniki funkcjonalne po leczeniu wewnątrznaczyniowym niż w przypadku leczenia konwencjonalnego po 90 dniach od rozpoczęcia leczenia. Jednak brakuje wyników długoterminowych wyników klinicznych. Metody
Ocenialiśmy wyniki kliniczne 2 lata po losowym przydzieleniu pacjentów do grupy leczonej endowaskularnie (grupa interwencyjna) lub konwencjonalnej (grupa kontrolna) w ostrym udarze niedokrwiennym. Pierwszorzędnym wynikiem był wynik zmodyfikowanej skali Rankina po 2 latach; ta skala mierzy wynik czynnościowy, z ocenami od 0 (bez objawów) do 6 (śmierć). Drugorzędne wyniki obejmowały umieralność ogólną i jakość życia po 2 latach, mierzone za pomocą wskaźnika użyteczności zdrowotnej, który opiera się na kwestionariuszu European Quality of Life-5 Dimensions (zakres ocen od -0,339 do 1, z wyższymi wynikami wskazujące na lepsze zdrowie). Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego”

Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5

Spośród 332 pacjentów już zapisanych w pierwotnym badaniu, 14 (4,2%) przeszło 2-letni okres obserwacji, a 87 (40 w grupie interwencyjnej i 47 w grupie kontrolnej) zmarło przed przedłużonym okresem obserwacji rozpoczął się okres. Spośród pozostałych 231 pacjentów włączonych do pierwotnego badania, ci, którzy nie wyrazili świadomej zgody na udział w rozszerzonym badaniu kontrolnym początkowo zostali ponownie zaproszeni do udziału: 61 pacjentów odmówiło, a 8 pacjentów wycofało zgodę w okresie obserwacji ( z tych 69 pacjentów, 18 było w grupie interwencyjnej, a 51 w grupie kontrolnej). W sumie 26 pacjentów straciło czas na obserwację. Ogółem 391 z 500 pacjentów (78,2%) miało 2-letnie dane kontrolne i włączono je do pierwotnej analizy wyników czynnościowych (194 w grupie interwencyjnej i 197 w grupie kontrolnej) (ryc. S1 w Dodatek). Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5”

Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5

Spośród 332 pacjentów już zapisanych w pierwotnym badaniu, 14 (4,2%) przeszło 2-letni okres obserwacji, a 87 (40 w grupie interwencyjnej i 47 w grupie kontrolnej) zmarło przed przedłużonym okresem obserwacji rozpoczął się okres. Spośród pozostałych 231 pacjentów włączonych do pierwotnego badania, ci, którzy nie wyrazili świadomej zgody na udział w rozszerzonym badaniu kontrolnym początkowo zostali ponownie zaproszeni do udziału: 61 pacjentów odmówiło, a 8 pacjentów wycofało zgodę w okresie obserwacji ( z tych 69 pacjentów, 18 było w grupie interwencyjnej, a 51 w grupie kontrolnej). W sumie 26 pacjentów straciło czas na obserwację. Ogółem 391 z 500 pacjentów (78,2%) miało 2-letnie dane kontrolne i włączono je do pierwotnej analizy wyników czynnościowych (194 w grupie interwencyjnej i 197 w grupie kontrolnej) (ryc. S1 w Dodatek). Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego ad 5”

Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego czesc 4

Śmiertelność z wszystkich przyczyn oceniano za pomocą metody Kaplana-Meiera i modelu proporcjonalnych hazardów Coxa, przy czym współczynnik ryzyka jako zmienną efektu. Dane wszystkich 500 pacjentów poddanych randomizacji w pierwotnym badaniu włączono do analizy śmierci z dowolnej przyczyny. Dodatkowe informacje z holenderskiej miejskiej bazy danych osobowych na temat zasadniczego stanu po 2 latach zostały wykorzystane do analizy wyników, a dane dotyczące pacjentów, których brakowało istotnego statusu, zostały ocenzurowane w momencie wycofania się z badania. W celu analizy jakości życia, wartość użyteczności dla każdego obserwowanego profilu stanu zdrowia EQ-5D-3L obliczono z wykorzystaniem istniejącego algorytmu na podstawie wyceny wywołanej przez techniki time-off stosowane w ogólnej populacji holenderskiej. Niestandaryzowany parametr regresji beta oszacowano przy użyciu wielozmiennego modelu regresji liniowej i przedstawiono różnicę między dwiema grupami leczenia w wyniku oceny użyteczności zdrowotnej. Read more „Dwuletni wynik po endowaskularnym leczeniu ostrego udaru niedokrwiennego czesc 4”

Choroba Pageta żuchwy

55-letni mężczyzna przedstawił 2-letnią historię bolesnego powiększania szczęki i stopniowo źle dopasowanych protez. Nie miał żadnych bólów głowy ani wad pola widzenia i nie miał nadmiernej potliwości, tłustej skóry, nietolerancji glukozy, niewydolności serca ani wzrostu rozmiaru rękawicy lub buta. Całą żuchwę powiększono obustronnie do kąta żuchwy (panele A i B), z zaznaczoną niewspółosiowością zębów górnych i dolnych. Poziom insulino-podobnego czynnika wzrostu I był prawidłowy przy 15,2 nmol na litr (normalny zakres, 9 do 40), ale poziom fosfatazy alkalicznej w surowicy i fosfatazy alkalicznej specyficznej dla kości były podwyższone (154 IU na litr [normalny poziom, < 120] i 92 IU na litr [normalny zakres, 15 do 41], odpowiednio). Badanie kości wykazało zwiększony wychwyt radionuklidu w szczęce (panel C); nie były zaangażowane żadne inne kości. Read more „Choroba Pageta żuchwy”

Leczenie komplikacji czerniaka za pomocą Natalizumabu na stwardnienie rozsiane

Obrazy siatkówki pacjenta 2. Panel A pokazuje prawy znamion naczyniówki, który był stabilny od co najmniej 1999 r. I który był uważnie obserwowany jako część częstych badań okulistycznych w zapaleniu nerwu wzrokowego i samym nevusie. Podczas rutynowego badania w listopadzie 2006 r., Po podaniu kilku dawek natalizumabu, zaobserwowano dramatyczny wzrost wielkości, głębokości i pigmentacji nerek i zdiagnozowano czerniaka ocznego (panel B).
Opisujemy dwa przypadki czerniaka u kobiet ze stwardnieniem rozsianym leczonych natalizumabem (Tysabri, Biogen Idec i Elan Pharmaceuticals), humanizowanym przeciwciałem monoklonalnym przeciwko integrynie .4. Read more „Leczenie komplikacji czerniaka za pomocą Natalizumabu na stwardnienie rozsiane”

Wydarzenia sercowo-naczyniowe podczas Pucharu Świata w Piłce Nożnej czesc 4

Współczynniki zachorowalności na zdarzenia sercowo-naczyniowe w dniach podczas mistrzostw świata, w porównaniu z dniami w okresie kontrolnym, w całej grupie iw podgrupach. Tabela 2. Tabela 2. Charakterystyka pacjentów, u których wystąpił ostry incydent sercowo-naczyniowy w dniach podczas Pucharu Świata w porównaniu z Dniami w Okresie Kontrolnym. Ciśnienie barometryczne było dodatnio związane ze wzrostem liczby zdarzeń sercowo-naczyniowych (wskaźnik zapadalności, 1,12 na 10 hPa), podobnie jak rok 2006 (1,15), wtorek (1,13) i niedziela (1,07); Sobota pokazała negatywne skojarzenie (0,78). Read more „Wydarzenia sercowo-naczyniowe podczas Pucharu Świata w Piłce Nożnej czesc 4”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 6

Czarni pacjenci prawdopodobnie otrzymają mniej odpowiednie leczenie na raka27, 28. Inne czynniki również wskazywały na niewystarczającą analgezję. Kobiety częściej miały wynik negatywny, podobnie jak pacjenci w wieku 70 lat lub starsi (ryc. 1). Pacjenci, którzy zostali oceniani jako mniej chorzy (lepszy stan sprawności ECOG) również częściej wykazywali niewystarczającą analgezję, podobnie jak pacjenci, których ból został przypisany przez lekarzy do przyczyn innych niż rak. Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 6”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd

Wprowadziliśmy [33P] deoksy-ATP do fragmentów DNA wytworzonych w procedurze PCR przez dodanie 2 mikrolitrów (10 mikro Ci) [33P] deoksy-ATP na 500 mikrolitrów mieszanin reakcyjnych i przez zmniejszenie stężeń nieznakowanego deoksy-ATP do 50 mM. W niektórych eksperymentach końcowy znakowano primer oligonukleotydowy 5 za pomocą [32P] .-ATP przed przeprowadzeniem PCR zamiast włączania [33P] deoksy-ATP podczas procesu amplifikacji. Wyznakowane produkty PCR rozdzielono na żelu sekwencjonującym (pomiar 0,4 mm na 20 mm na 60 mm) w temperaturze 60 do 80 W mocy stałej przez dwie do czterech godzin. Żele umieszczono w plastikowym opakowaniu i wystawiono na działanie filmu rentgenowskiego przez jeden do pięciu dni w temperaturze pokojowej. Polimorfizm EVI-20 wykryto przednim starterem 5 CCCATACCTAGTTCTTAAAGTCTGT3 i odwrotnym primerem 5 TAACAATTGTGGAACTGCAGCAATTATT3 . Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd”