Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad 5

Mutacje genów NF1 i RAS mogą mieć takie same biochemiczne konsekwencje dla wzrostu komórek (tj. Zwiększone poziomy Ras-GTP). Po trzecie, komórki szpiku kostnego od dzieci z młodzieńczą przewlekłą białaczką szpikową i monosomią 7 wykazują nieprawidłową charakterystykę wzrostu w układach hodowlanych, które wspomagają rozwój kolonii pochodzących z hematopoetycznych komórek progenitorowych33-35. Komórki uzyskane od pacjentów z młodzieńczą przewlekłą białaczką szpikową i monosomią 7 tworzą kolonie w nieobecności egzogennych czynników wzrostu. Ostatnie dane wskazują, że te komórki mają również wyraźną i selektywną nadwrażliwość na czynnik stymulujący kolonizację granulocytów-makrofagów34, 35. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad 5”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 czesc 4

Normalny matczyny allel jest obecny w szpiku kostnym Pacjenta 8. W Tablicy E DNA z Pacjenta 11 i jej rodziców zostało zamplifikowane ze starterami, które wykrywają polimorfizm EVI-20 (top blot) i polimorfizm opisany przez Andersena i wsp.27. (dolna plama). Macierzysty allel NF1 został usunięty u pacjenta. JCML oznacza młodzieńczą przewlekłą białaczkę szpikową i przewlekłą białaczkę mielomonocytową CMML. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 czesc 4”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd

Wprowadziliśmy [33P] deoksy-ATP do fragmentów DNA wytworzonych w procedurze PCR przez dodanie 2 mikrolitrów (10 mikro Ci) [33P] deoksy-ATP na 500 mikrolitrów mieszanin reakcyjnych i przez zmniejszenie stężeń nieznakowanego deoksy-ATP do 50 mM. W niektórych eksperymentach końcowy znakowano primer oligonukleotydowy 5 za pomocą [32P] .-ATP przed przeprowadzeniem PCR zamiast włączania [33P] deoksy-ATP podczas procesu amplifikacji. Wyznakowane produkty PCR rozdzielono na żelu sekwencjonującym (pomiar 0,4 mm na 20 mm na 60 mm) w temperaturze 60 do 80 W mocy stałej przez dwie do czterech godzin. Żele umieszczono w plastikowym opakowaniu i wystawiono na działanie filmu rentgenowskiego przez jeden do pięciu dni w temperaturze pokojowej. Polimorfizm EVI-20 wykryto przednim starterem 5 CCCATACCTAGTTCTTAAAGTCTGT3 i odwrotnym primerem 5 TAACAATTGTGGAACTGCAGCAATTATT3 . Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad

Zbadaliśmy próbki DNA z 11 rodzin, w których złośliwe zaburzenie szpiku rozwinęło się u dziecka z NF-1 i przedstawiliśmy dane sugerujące NF1 jako supresor guza w komórkach hematopoetycznych linii mieloidalnej. Metody
Tabela 1. Tabela 1. Cechy dzieci z NF-1 i złośliwymi zaburzeniami szpikowymi. Przebadaliśmy 10 chłopców i dziewczynę z NF-1 i MPS (9 pacjentów) lub AML (2 pacjentów), którzy byli leczeni w pediatrycznych ośrodkach referencyjnych. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1

Białka kodowane przez rodzinę proto-onkogenów RAS regulują wzrost i różnicowanie komórek przez cykliczne przechodzenie między stanem aktywnym, w którym są związane z trifosforanem guanozyny (Ras-GTP) a stanem nieaktywnym, w którym są związane z difosforanem guanozyny (Ras-GDP) ) 1,2. Podczas rozwoju raka u ludzi, geny te powszechnie nabywają aktywujące mutacje punktowe, które zakłócają biochemiczną aktywność białek Ras przez podwyższenie poziomu Ras-GTP3. Drożdżowe i ssacze białka aktywujące GTPazę normalnie regulują biologiczną aktywność białek Ras, przyspieszając hydrolizę GTP. Ponieważ Ras-GTP aktywnie trandukuje sygnały, białka aktywujące GTPase działają (przynajmniej częściowo) jako negatywne regulatory funkcji Ras. Neurofibromina, białko kodowane przez gen, który jest zmutowany u pacjentów z autosomalnym dominującym zaburzeniem genetycznym neurofibromatoza typu (NF-1), wykazuje homologię sekwencji z białkami aktywującymi GTP-a drożdży i ssaków4-6. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 7

Dostępnych jest kilka narzędzi oceny w celu standaryzacji oceny bólu i zminimalizowania potencjalnych błędów w oszacowaniach lekarzy dotyczących nasilenia bólu u pacjentów14,32,33. Chociaż wiele czynników przyczynia się do złego zarządzania bólem nowotworowym, 7, 9, 10, 14 pacjentów powinno odczuwać mniejszy ból, gdy jest odpowiednio oceniany i odpowiednio leczony. Finansowanie i ujawnianie informacji
Wspierane przez granty od publicznej służby zdrowia (CA 21115 do Wschodniej Spółdzielczej Grupy Onkologii i CA 26582 do Grupy Badań nad Bólu), National Cancer Institute, National Institutes of Health oraz Department of Health and Human Services.
Jesteśmy wdzięczni Pani Karen Ryan za pomoc w przygotowaniu manuskryptu.
Author Affiliations
Od Pain Research Group, Department of Neurology (CSC) i University of Wisconsin Comprehensive Cancer Center (CSC, JAS), Madison; Dana-Farber Cancer Institute, Boston (RG); Carle Cancer Center, Urbana, Ill. Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 7”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 6

Czarni pacjenci prawdopodobnie otrzymają mniej odpowiednie leczenie na raka27, 28. Inne czynniki również wskazywały na niewystarczającą analgezję. Kobiety częściej miały wynik negatywny, podobnie jak pacjenci w wieku 70 lat lub starsi (ryc. 1). Pacjenci, którzy zostali oceniani jako mniej chorzy (lepszy stan sprawności ECOG) również częściej wykazywali niewystarczającą analgezję, podobnie jak pacjenci, których ból został przypisany przez lekarzy do przyczyn innych niż rak. Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 6”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 5

Wyniki analizy mającej na celu zidentyfikowanie czynników predykcyjnych wyników dotyczących wskaźnika leczenia bólu przedstawiono w Tabeli 2. Poza typem populacji obsługiwanej przez instytucję (mniejszość vs nieminoralność) przewidywano szereg innych zmiennych demograficznych i związanych z chorobą wyniki. Im większa rozbieżność między lekarzem a pacjentem w ocenie stopnia zakłócenia wywołanego bólem z aktywnością, tym bardziej prawdopodobny jest wynik ujemny. Negatywny wynik był również bardziej prawdopodobny u pacjentów, których ból nie był związany z rakiem, pacjentów, którzy byli w najstarszym kwartylu próbki (70 lat lub starszych), pacjentów, którzy zostali uznani za mniej chorych (lepszy stan sprawności ECOG), oraz kobiety (ryc. 1). Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym ad 5”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym czesc 4

Zmienne prognostyczne zostały uwzględnione w wieloczynnikowej analizie regresji logistycznej z etapową selekcją. Predykator był uważany za kandydata, jeśli miał marginalne powiązanie (P . 0,25), zgodnie z bieżącą praktyką23. Początkowo stosowano wartość odcięcia 0,25 i zmniejszono ją do 0,05 w ostatecznym modelu, tak że nie wykluczono przypadkowo silnych predyktorów. Spowodowało to wyeliminowanie 11 z 18 możliwych predyktorów. Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym czesc 4”

Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym cd

Brak bólu oceniano jako 0, łagodny ból jako 1, umiarkowany ból jako 2, a silny ból jako 3. Wskaźnik leczenia bólu, obliczony przez odjęcie poziomu bólu od poziomu analgetycznego, wynosi od -3 (pacjent z silny ból nie otrzymujący żadnych leków przeciwbólowych) do +3 (pacjent otrzymujący morfinę lub jej odpowiednik i nie zgłaszający bólu). Uznano, że ujemne wyniki wskazują na nieodpowiednie zamówienia leków przeciwbólowych, a wyniki 0 lub wyższe uważa się za konserwatywny wskaźnik akceptowalnego leczenia. Indeks zarządzania bólem mierzy reakcję dostawcy usług opieki zdrowotnej na ból pacjenta; na przykład, leczenie bólu nie jest uważane za niewystarczające, jeśli pacjent nie stosuje się do przyjmowania leków. Indeks bierze również pod uwagę leki przepisane niedawno, ale jeszcze nie zażywane. Read more „Ból i jego leczenie u pacjentów ambulatoryjnych z rakiem przerzutowym cd”