Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad 5

Mutacje genów NF1 i RAS mogą mieć takie same biochemiczne konsekwencje dla wzrostu komórek (tj. Zwiększone poziomy Ras-GTP). Po trzecie, komórki szpiku kostnego od dzieci z młodzieńczą przewlekłą białaczką szpikową i monosomią 7 wykazują nieprawidłową charakterystykę wzrostu w układach hodowlanych, które wspomagają rozwój kolonii pochodzących z hematopoetycznych komórek progenitorowych33-35. Komórki uzyskane od pacjentów z młodzieńczą przewlekłą białaczką szpikową i monosomią 7 tworzą kolonie w nieobecności egzogennych czynników wzrostu. Ostatnie dane wskazują, że te komórki mają również wyraźną i selektywną nadwrażliwość na czynnik stymulujący kolonizację granulocytów-makrofagów34, 35. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad 5”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 czesc 4

Normalny matczyny allel jest obecny w szpiku kostnym Pacjenta 8. W Tablicy E DNA z Pacjenta 11 i jej rodziców zostało zamplifikowane ze starterami, które wykrywają polimorfizm EVI-20 (top blot) i polimorfizm opisany przez Andersena i wsp.27. (dolna plama). Macierzysty allel NF1 został usunięty u pacjenta. JCML oznacza młodzieńczą przewlekłą białaczkę szpikową i przewlekłą białaczkę mielomonocytową CMML. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 czesc 4”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd

Wprowadziliśmy [33P] deoksy-ATP do fragmentów DNA wytworzonych w procedurze PCR przez dodanie 2 mikrolitrów (10 mikro Ci) [33P] deoksy-ATP na 500 mikrolitrów mieszanin reakcyjnych i przez zmniejszenie stężeń nieznakowanego deoksy-ATP do 50 mM. W niektórych eksperymentach końcowy znakowano primer oligonukleotydowy 5 za pomocą [32P] .-ATP przed przeprowadzeniem PCR zamiast włączania [33P] deoksy-ATP podczas procesu amplifikacji. Wyznakowane produkty PCR rozdzielono na żelu sekwencjonującym (pomiar 0,4 mm na 20 mm na 60 mm) w temperaturze 60 do 80 W mocy stałej przez dwie do czterech godzin. Żele umieszczono w plastikowym opakowaniu i wystawiono na działanie filmu rentgenowskiego przez jeden do pięciu dni w temperaturze pokojowej. Polimorfizm EVI-20 wykryto przednim starterem 5 CCCATACCTAGTTCTTAAAGTCTGT3 i odwrotnym primerem 5 TAACAATTGTGGAACTGCAGCAATTATT3 . Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 cd”

Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad

Zbadaliśmy próbki DNA z 11 rodzin, w których złośliwe zaburzenie szpiku rozwinęło się u dziecka z NF-1 i przedstawiliśmy dane sugerujące NF1 jako supresor guza w komórkach hematopoetycznych linii mieloidalnej. Metody
Tabela 1. Tabela 1. Cechy dzieci z NF-1 i złośliwymi zaburzeniami szpikowymi. Przebadaliśmy 10 chłopców i dziewczynę z NF-1 i MPS (9 pacjentów) lub AML (2 pacjentów), którzy byli leczeni w pediatrycznych ośrodkach referencyjnych. Read more „Utrata normalnego allelu NF1 ze szpiku kostnego dzieci z neurofibromatozą typu 1 i złośliwymi zaburzeniami mielobożności typu 1 ad”